Why I Believe Phil 2:5-8 is Not about Pre-existence

Discussion in 'General Discussions' started by Imabetterboy, Apr 4, 2018.

  1. 0
    0
    0
    Earthbound

    Earthbound Guest

    Brother, I want to thank you for such kind words, and I've appreciated your contributions to the discussion.

    Your zeal is your strength, and the only way you will improve in more tempered responses is by exercise, so keep the posts coming. This forum has been a positive force for entertaining discussions such as this, which can be problematic simply because of the controversial nature of them. Exercise the same patience you would like to receive.

    And thank you for starting this discussion, which has resulted in pages of information for readers to consider and meditate upon as we've covered point after point! It has been the first one which I actually participated in from start to finish, out of the others I started to, only to leave off and then forgot to come back, LOL

    As Joshuastone7 will attest!! :eek:

    A fellow slave,
    Timothy

    PS. I mention you in my response to Joshuastone7, so be sure to make time for reading through it. ;)
     
  2. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    Joshua,Christian greetings!
    It is good to see that we do agree on some points and it is refreshing. I'm drawn attention to the possiblity of Jesus life force is preexistence. This to me does put a different perspective to it. The problem I have with this is that it is not a conscious life force. It was in God's mind and purpose to provide a redeemer that would correspond to the life Adam lost for mankind. And just as Jehovah was the progenitor of Adam's LIFE. So to was Jehovah progenitor of Jesus LIFE. The only difference being that Adam was a direct creation fully formed out of the ground when God breath his spirit into him to become a LIVING BEING. The second man Jesus was formed by pregnancy (procreated) when God activated her seed cell out of his holy spirit. = the new life, = the new man.

    Just as human fathers pass (life) on to their chilren. So did Jehovah pass (life) on to his son. (This is not a recycle life from another creature but the life that comes out of God's own holy spirit.)

    This (LIFE) is the everlasting life that was with the father. We too can have that life by adoption by means of the holy spirit!

    Agape! and Peace!
     
  3. 4,693
    840
    113
    Joshuastone7

    Joshuastone7 Administrator Staff Member

    Joined:
    Jan 26, 2013
    Messages:
    4,693
    Likes Received:
    840
    Trophy Points:
    113
    Gender:
    Male
    I couldn't have said it more eloquently... You are a gifted conciliator, no doubt an attribute from our Father...

    I agree this is a good point to wind down this conversation...lol Maybe a cup of Joe to cap it off? :)

    160+ comments is quite a run, especially given the content, and the amount of information, and brain power... Ha

    I had forgotten what it's like to be the new one to a platform such as this. It reminds me of when I first became a member of another forum under a previous owner. I was so confident that I would stumble over myself, and make points without considering all possible objections. It really was a learning experience. You find out real quick where you stand in your level of study for sure...

    You know, it's interesting, he and I have closer views then probably anyone else I know, but time and unforeseen circumstances befall us all. Even among Christs brothers, there is discord. I have a feeling though, that one day, many things are going to change. Or perhaps a better word is "faith".

    You of course are right...

    Amen...

    Well said, and I appreciate you keeping our thread on track, we are a family of differing gifts from Jehovah, and when we come together we have our Lord here with us as well, and who could over power him? In the end it doesn't matter who is right or wrong, but that we push through, and still come together in order to show ourselves waiting for when he knocks!

    All love in The Way...

    AJ
     
  4. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    There is no denying Jesus is the man from heaven, (he never had an earthly father). He is the one promised numerous times throughout God's written word from Gen to Mal.

    However, what we differ on is, this: Is Jesus "life," (a)The life of a pre-existing person Michael or (b) Is his "life" out of God's own holy spirit, who fathered Jesus by a miraclous conception? A new creation.

    Rather than a transfer of a previous life, but a begotten son by pregnacy. Out of (ek) God and out of (ek) Mary. Not out of Michael and Through (dia) Mary. Matt 1:1-20.

    Jesus is a man, 30-33 years of age? How long have men lived?? Please tell? :confused: As I am not aware of any man living prior to his Mother or His Father.:confused: And I don't believe Jesus wants me to believe bazaar things :eek:like that? Which in itself goes contrary to God's principles of truth.

    So if he is a man of 30 years plus, than he cannot have a mind or memory longer then his given life span. Luke 3:23.

    I don't believe Jesus was speaking of a pre-existences, but that he was the anointed one as foretold (foreknown) in scriptures and he remindered his listeners of those facts.(Jn 5:45-47)

    So the Bible tells us different things, It tells you one thing and to others, different things.

    Brotherly Love.:)
     
  5. 2,763
    999
    113
    Tsaphah

    Tsaphah Experienced Member

    Joined:
    Feb 18, 2013
    Messages:
    2,763
    Likes Received:
    999
    Trophy Points:
    113
    To Imabetterboy,
    I am having a difficult time trying to write this without sounding harsh or offensive. I always try to listen to other viewpoints. I don’t know your particular background. It appears to me that you are only here to cause divisions. The apostle Paul had to deal with situations where certain individuals joined the congregations in Greece, with philosophical view points, that went against the teachings of the accepted Hebrew scriptures, and the teachings of Jesus Christ. This was especially true with the church in Corinth. There were those who did not understand the truth. They started questioning what certain writings meant because the ideas and information was beyond their grasp. They “thought” they knew the answers to the “meat” of the scriptures, yet they were actually babies. Like a baby, they could not digest the heavier ideas which had the answers to specific events.

    Paul said, “And, brothers, I was not able to speak to you as to spiritual ones, but as to fleshly ones, as to babes in Christ. I gave you milk to drink, and not food, for you were not then able, but neither now are you yet able. For you are yet fleshly. For where among you is jealousy, and strife, and divisions, are you not fleshly and walk according to man?” ( 1 Co 3:1-3 LITV )

    It is not important what you, or I, think. It is not important what opinions you, or I, have of the meanings of scripture. What is important is the truth! The truth in the Bible is only ambiguous to those who lack understanding. It is like a young Jewish child thinking that a hamburger is made of ham. Therefor, they are forbidden to eat it.

    If a baby eats solid food, it’s digestive system cannot process the solids, and it could die. We also would be wasting our time trying to explain to the baby why they cannot eat solid food. Their language capabilities are inadequate. They lack understanding of the words. The same holds true with a babe in Christ. They lack the understanding of Who Christ Is. That is very important!

    I may be wrong, but I may be right. I “think” your object here is to cause division. My hope is that you prove me wrong.
     
    Joshuastone7 likes this.
  6. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    Sorry, You feel that way!

    All you have to do is explain to me, how a man of 30 - 33 years of age pre- exist himself, and his Father anf his Mother and his forefathers! How can a man of 30 years plus have existence of a previous life? In my eyes, It is fantasy and it is false!!!

    It is just not true! It's not possible, and It is contrary to God's own heredity laws. If that causes a division than I'm lost for words!

    The Bible clearly shows he was "begotten", not transferred, to His mother, Mary in the first century out of his fathers spirit and out of his Mother. Matt 1:1:20, "Conceived" just as John the Baptist was Conceived. Luke 1:36. Both were miraculous conceptions. That does not teach pre-existence. Was John the baptist also transferred from heaven?

    No division causing, just seeking the truth!

    If God and Jesus speak the truth! Which I believe they do. And if someone one can pre-exist their Father and Mother as you propose, than what your doctrine is, is no better than what Trinitarians believe.They believe God can be a man! Because he can do impossible things.

    All I want is honesty! It seems you want me to conform to things that are absurdity.

    I'm am willing to listen to logical and meaningful reason!
     
  7. 2,763
    999
    113
    Tsaphah

    Tsaphah Experienced Member

    Joined:
    Feb 18, 2013
    Messages:
    2,763
    Likes Received:
    999
    Trophy Points:
    113


    It appears that you are obviously unfamiliar with Paul’s instructions to Timothy. “If anyone advocates a different doctrine and does not agree with sound words, those of our Lord Jesus Christ, and with the doctrine conforming to godliness, he is conceited and understands nothing; but he has a morbid interest in controversial questions and disputes about words, out of which arise envy, strife, abusive language, evil suspicions, and constant friction between men of depraved mind and deprived of the truth, who suppose that godliness is a means of gain.” ( 1 Tim 6:3-5 NASB )

    The Greek word translated as “conceived” in Matthew 1:20 is gennao (ghen-nah’-o), the same word as we use in English as “generate”/ “gene” / “genetic”. There is a supposedly “new” science called “in vivo fertilization”, meaning: (of a biological process) occurring or made to occur within a living organism or natural setting, the union of male and female gametic nuclei. If you are not familiar with this process, it happens quite often in hospitals. This is where a women has difficulties becoming pregnant in the usual way. It is also done with animals, such as championship race horses, dogs, cattle, sheep, etc. It is usually done this way to insure that the “genetic code” of the donor will be of the championship line.

    It is explained in verse 20b, “. . . because what is conceived/gennao in her is from the Holy Spirit.
    Today, scientific geneticists state “the human genome reads, for three billion letters, like this: ‘atgtctggctctgttccccagactggagtgcggcgac . . .’ The supercomputer that assembled one of the initial human sequences examined 26 million fragments and made 500 quintillion—that’s 500 million trillion—base-to-base comparisons.” Who is the designer and maker of this code? The creator of all things knows how to “in vivo fertilize” a specific women with the code of the individual who became the human we know as Jesus Christ. Oh, by the way, Christ is not his last name!

    “It is better to keep your mouth closed and let people think you are a fool than to open it and remove all doubt.” - Mark Twain
    “Education: that which reveals to the wise, and conceals from the stupid, the vast limits of their knowledge.” - Mark Twain

    It is obvious from your statements in your post that you fail to meet the minimum understanding of the Bible. You just proved by those words that you intend to sow discourse and your object here is to cause division.
     
  8. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    Lols!
    Yeah, I'm sure they knew all about that (in vivo fertilize) in the first century!

    And I'm sure God knew what he was doing when he created Adam out of the ground and breathed into him the breath of life! Gen 1:26, Gen 2:7-8 And I'm sure he knew that for the nearly 40 times he had inspired the Bible writer of Matthew 1:1-20 to write "gennao (ghen-nah’-o) = use in English as “generate", He meant the same thing!!!!

    But thank God for "modern technology"! You somehow seem to indicate a difference at verse 20! Lols! This is how you justify, begotten no longer means begotten but transfer! Lols! You rely on modern technology rather than the Bible! haha

    And Yes! I know Christ is not a last name. It is a title he was offically given at his baptism to become the chosen one = the anointed one.Acts 10:38, Luke 4:16-22. Jn 1:41-45.

    OK Lets stop there! As I don't want to upset anyone with the truth!

    You did nothing to answer some simple logical Bible truth questions! (in vivo fertilize) Proves moot! It certianlly didn't explain how a person pre-exist themselves, or their mother, or their father, or their forefather! lols!!

    For starters HALF of Jesus was in Mary, waiting for the other half! So only half of him pre-existed!

    You simply don't know! If you want to believe those foolish things so be it! Deal me out! Mark Twain!

    Cheers!
     
    Londoner likes this.
  9. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    I am a skeptical believer that's true! God does not want me to believe foolish or absurbs things!

    I don't accept everything someone says to me is truth! I'm like the Bereans who check to see if these things are true! I believe in truth! I am persuaded by truth, not my myths or foolish or absurbs things! That doesn't make my faith in God weak or untrue. I just don't see eye to eye with everything that is proposed as truth.

    I believer Jehovah, but when some one says to me Jehovah is Jesus! Of course I'm going to laugh! That is silly and stupid (but the people who believe it are very sincere it is true), God is not a man that he should lie!! Nub 23:19. (And I'm not saying Tsaphah said that, just illustrating a point)

    Now ! Tsaphah, maybe a wonderful brother and believes what he believes in all sinceriousness to be true!

    He accuses me of causing division! I have simply shown there are other ways to understand the Bible.

    I am not persuaded by what a person assumes to be true. Reardless of how sincere they may be.!

    I have raised some personal questions, and views that are contrary to the general accepted view of the WTS. But in my eyes are logically true and reasonable.

    If my views cannot be answered honestly and logically, without the threat that I am causing division. Than so be it! I'll hop out! I thought this may be a channel where things could be discussed openingly,and freely, maybe I was wrong!

    Brotherly love!
     
    Londoner likes this.
  10. 2,763
    999
    113
    Tsaphah

    Tsaphah Experienced Member

    Joined:
    Feb 18, 2013
    Messages:
    2,763
    Likes Received:
    999
    Trophy Points:
    113
    For Iambetterboy,
    I have thought long and hard about your request; to explain how Jesus could have a pre-existence. In other words, a life, the state or fact of existing before he became a human being. I have posted other information which covered some of the information several years back. So, . . . I’ll try to explain this in a logical way, along with scriptural backing.

    First of all let’s look at a few scriptures that use specific words that give us clues to this pre-existence. For starters we have the words of Paul, in his letter to the Colossians, he explained who Jesus was; “He is the image of the invisible God, the firstborn of all creation.” ( Col 1:15 NASB ) There are several key words that we need to understand. The first word is image. In the Greek language, image = eikon = figure, likeness. Or, a representation of something. We have the English word: Icon = a picture, image, or other representation. Example: f is an icon for Facebook, an icon for twitter, an Icon for Apple. A cross is worn by many claiming to be Christians. It isn’t the real thing, it is only a representation. You may also represent your work, family head, etc.

    Another key word is firstborn. In the Greek language, firstborn = prototokos (pro-tot-ok'-os). It is a compound word from: protos = first in time or place, first in rank. We have an English word that comes from the Greek, prototype = the original or model on which something is based or formed. Or, someone or something that serves to illustrate the typical qualities of a class.

    The third key word is creation. In the Greek language, creation = ktisis (ktis-is) = The act of founding, establishing, building, etc. From the combination of this example used by Paul, we find that the person we know as Jesus was the first thing that Jehovah God created. Many people believe He is the one whom Jehovah addresses when He says: “Then God said, ‘Let Us make man in Our image, according to Our likeness; and let them rule over the fish of the sea and over the birds of the sky and over the cattle and over all the earth, and over every creeping thing that creeps on the earth.’ God created man in His own image, in the image of God He created him; male and female He created them.” ( Gen 1:26-27 NASB )

    Let’s look at the Hebrew version, after all the account recorded in Genesis was written in Hebrew. The word translated as image is tselem (tseh'-lem) = image, likeness (of resemblance). There are 18 different words or combination of words that can be translated as image, or similar meaning. Some words are: form, image, images, likenesses, phantom, depending on the subject matter.

    One of the other Hebrew words is bekor (bek-ore' ) firstborn, firstling of men and women, relation, “And Jacob said to his father, I am your first born, Esau. I have done as you said to me. Rise up now, sit and eat of my game, so that your soul may bless me.” ( Gen 27:19 LITV )

    When we go back to the Greek written by Paul, we find more reference to the use of the word prototokos. “But we know that all things work together for good to those who love God, to those who are called according to purpose; because whom He foreknew, He also predestinated to be conformed to the image of His Son, for Him to be the First-born among many brothers.” (Ro 8:28-29 LITV )

    For to which of the angels did He ever say,
    ‘You are My Son,
Today I have begotten You”?
    And again,
    ‘I will be a Father to Him
And He shall be a Son to Me’”?
    “And when He again brings the firstborn into the world, He says,
    ‘And let all the angels of God worship Him.’” ( Heb 1:5-6 NASB )

    Jehovah God created this “first born” (prototokos) as the first of his creations. One of the things we do not know is: what is the makeup of spirit creatures/angels? We don’t know! There is something that we do know, and that is the makeup of physical things. The structure is DNA (deoxyribonucleic acid), “a self-replicating material present in nearly all living organisms as the main constituent of chromosomes. It is the fundamental and distinctive characteristics or qualities of someone or something, especially when regarded as unchangeable.”

    Deoxyribonucleic acid is a thread-like chain of nucleotides carrying the genetic instructions used in the growth, development, functioning and reproduction of all known living organisms and many viruses. DNA and ribonucleic acid (RNA) are nucleic acids; alongside proteins, lipids and complex carbohydrates.

    Here is a question. Who is the one that created this DNA, and its code? One thing to remember: (Gen 1:11-13, 20-31) Also what seems to be evident is that the soils that make up the ground has a genetic code/DNA, as the human body when dead, is absorbed back into the earth. (Gen 2:7, 3:19)

    Now, to address the question of how Jesus could have a pre-existence. God knows how to create life within His created universe. He knows the DNA structure and how to transform it. Forget about the 30 year old Jesus. It started a long time before that time period. It started way back there in Gen 3. Or possibly before that time. If Man can perform an in-vivo fertilization to bring about a full human child, don’t you think God knows how to do a better job?

    As a young child, Jesus knew who he was. “And He said to them, “Why is it that you were looking for Me? Did you not know that I had to be in My Father’s house?” (Luke 2:49 )

    All things have been handed over to Me by My Father, and no one knows who the Son is except the Father, and who the Father is except the Son, and anyone to whom the Son wills to reveal Him.” (Luke 10:22 )

    Not everyone who says to Me, ‘Lord, Lord,’ will enter the kingdom of heaven, but he who does the will of My Father who is in heaven will enter.” (Mt 7:21)

    All things have been handed over to Me by My Father; and no one knows the Son except the Father; nor does anyone know the Father except the Son, and anyone to whom the Son wills to reveal Him.” ( Mt 11:27)

    I speak the things which I have seen with My Father; therefore you also do the things which you heard from your father.” (John 8:38)

    John testified about Him and cried out, saying, ‘This was He of whom I said, ‘He who comes after me has a higher rank than I, for He existed before me.’” (John 1:15)

    This is He on behalf of whom I said, ‘After me comes a Man who has a higher rank than I, for He existed before me.’” (John 1:30)

    The answer is found in Paul’s first letter to the Corinthians and Philippians.

    Have this attitude in yourselves which was also in Christ Jesus, who, although He existed in the form of God, did not regard equality with God a thing to be grasped, but emptied Himself, taking the form of a bond-servant, and being made in the likeness of men. Being found in appearance as a man, He humbled Himself by becoming obedient to the point of death, even death on a cross.” (Phil 2:5-8)

    For as in Adam all die, so also in Christ shall all be made alive. But each one in his own order; the first-fruit Christ, afterward those that are Christ’s at his coming: then the end, when he shall have delivered up the kingdom to the God and Father, when he shall have destroyed all principality and all authority and power. For he must reign till he shall have put all enemies under his feet. Death, the last enemy, shall be destroyed. For he has put all things under his feet. But when he shall have said that all things have been subjected, it is evident that he is excepted who subjected all things to him; but when all things shall have been subjected to him, then shall the Son also be subjected to him who subjected all things to him, that God may be the all in all.” (1 Cor 15:22-28 Codex )
     
  11. 4,693
    840
    113
    Joshuastone7

    Joshuastone7 Administrator Staff Member

    Joined:
    Jan 26, 2013
    Messages:
    4,693
    Likes Received:
    840
    Trophy Points:
    113
    Gender:
    Male
    Thank you very much for that contribution dear brother...
     
  12. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    Greetings Tsaphah!
    Thanks for taking the time, to give your view of how Jesus pre-exists himself! As I am of the opinion None of mankind preexists their mother or father, and that, to me is illogical and contradictory to God's natural laws of heredity as outlined in scripture. Gen 1:11-12, 20-31, Matt 1:1-20

    So with that in mind, please do not take offensive to my objections to your view. I will present, in answer to (your suppositions) and I call them suppostions, simply because that is how I see them. I too was of thoses views, being first a Trinitarian, than one of Jehovah's Witnesses, which I still am, though my views have changed a lot because of personal study and logical reasoning.
    On Col 1:15.
    I understand this scripture is taken out of context, and being used as proof of the original creation. When in fact it is about Jesus being the firstborn of the new creation. The first of all those who will be given everlasting life.

    My first reason for saying that, is verse 13-14, 19-20, is left out of the context, which tells us God had transferred the disciples from under the authority of darkness into the authority of his son by means of the ransom. Paul also refers to this union as a new creation.

    ** 2 Cor 5:17 Therefore, if anyone is in union with Christ, he is a new creation; the old things passed away; look! new things have come into existence. 18 But all things are from God, who reconciled us to himself through Christ and gave us the ministry of the reconciliation,19 namely, that God was by means of Christ reconciling a world to himself, not counting their offenses against them, and he entrusted to us the message of the reconciliation.

    My second reason, is that the context is about the new authority under Christ. I do not see any thing in the context that would suggest the original creation of animals or birds or trees etc. But I do see governments and thrones and authorities (many of theses, being the works of the devil, Paul tells us to Eph 6:11-12 to put on our armor against.) So he can hardly be giving credit to Jesus for "creating" these govenments etc.) But I do see in the context. Jesus on winning victory over death and these authorities, he has been given headship over them allowing them time for reconcilation.

    ** Col.2:10,15.So you have acquired a fullness by means of him, the one who is the head of all government and authority.....15 He has stripped the governments and the authorities bare and has publicly exhibited them as conquered, leading them in a triumphal procession by means of it

    I agree, with the thought Jesus represents God And so He is in the compacity of God having all authority bestowed upon him to bring all things together again..

    On the word firstborn.
    If he is first born OF ALL creation, he cannot be before creation as he is "the product" of creation! The scripture is not saying he is the first created son. It is saying out of all of God's created sons he is the only one to be begotten by pregnancy namely out of Mary..

    I agree in principle that firstborn can be applied in a number of ways. To wit. 1) He can be placed as firstborn over the kings of the earth. Ps 89:27. This could easily apply here. 2) It could mean he is the first of God's sons to be begotten of creation (Mary being of Creation), all other sons of God were created. Angels which are not produced by heredity, and Adam the first earthly son of God was created out of the ground. Jesus is the only son of God to have been begotten of creation (out of Mary) Luke 2:7, 23. Matt 1:25
    And it can also mean he is the firstborn of the new creation.Rom 8:29 The new humanity. Eph 2:15 The firstborn to everlasting life. Col 1:18

    Prototype (= first type,) is not used at Col 1:15, nor is Protoktisis (= first-created) it uses the word prototokos (pro-tot-ok'-os). It is a compound word from: protos = first in time or place, first in rank and tiktō = to be born, Matt 1:25, Luke 2:7 It means first in rank, an heir, to have preeminence in position.To be firstborn you have parents that are your progenitors

    On Gen 1:26-27
    This scripture is ambigious! There is at least 4-5 ways to interupt this verse. 1) as equal Gods of a Trinity, 2) As WTS Archangel, 3) the council of angelic hosts in heaven,4) as the royal "Us" 5) metaphorically, as when talking to the earth, and water to put forth living things.Gen 1:20,24,
    At Luke 2:11 The angels declared : For today there was born to you in David’s city a savior, who is Christ the Lord.
    Never were the words of Hebrews addressed to an heavenly angel but to the prophet David, 2 Sam 7:14, Luke 1:32
    When Jesus was resurrected God gave him all authority, even the angels were to be in subjection to him.
    I have no problem with the code! That is my whole point! The law of heredity says each produce after their own kind! Man produces man kind! God created Adam out of the ground and breathed into him the breath of life. God was his father or progentor who gave him life out of his spirit.Ps 36:9.

    I believe in miracles, God caused Mary's seed cell to be come activated with the spirit of life from out of his own spirit. Matt 1:18, 20. Just as he gave life to Adam, he gave life to Jesus, one was created the other begotten by pregnancy. Did God put an angel into Adam??? Not that I know of!!! So why would the God of truth put an angel into David's seed??? When all that is necessary is for God to activate the seed with spirit of life from out of himself, just as he had done with Adam.A very small task for the Almighty!
    There was no perfect man to pass the perfect spirit of life (as Adam had corrupted that) to the seed of David and so as promised to David, God said he would be the father. 2 Sam 7:14. So Jesus had an earthly Mother but a heavenly Father. The unique son of God, and of man.

    I have covered a small amount of your response, and as short and consise as I could. I am not one for spending a lot of time dressing up what I have to say, and sometimes that may come across abrubtly and I don't want that to be the case. I appreciate your comments, and will try to address the rest to-morrow.

    May you have God's blessings and Joy.
     
    Londoner likes this.
  13. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    Christian Greeting Tsaphah!!
    I feel a little refreshed after a good night sleep.
    Now to continue with my response to your proposition on how Jesus pre-existed his mother and father!

    You tell me to forget that Jesus is a 30 year old man. I don't know why you would want me to forget that, as that is what the Bible teaches me he is!. Jn 1:30,Jn 8:40, Luke 3:23. That is the reality of the matter.

    I agree, that it started a long time ago, but not as reality, but as God's purpose to undo the wrong done by Adam who rebelled against God, and failed to fulfil his God given responsibilities. Gen 1:26-31, Gen 2:15-17.

    So, God made a promise that a redeemer, would come from the seed of the woman, whom would be bruised in the heel, and raise up to victorious glory to undo the wrong committed by Adam and remove the instigator of the rebellion and restore God's original purpose for this earth. Gen 3:15. Acts 3:21.

    The fulfilment of that promised became a reality when God fathered the seed of David within Mary womb with life out of his holy spirit.

    ** 2 Sam 7:14 ...I will become his father, and he will become my son..... (I might add this is future tense so the son could not be preexisting, anymore than Solomon was pre-existing, except in God's mind as the one promised to come.)

    ** Luke 1:32 And look! you will become pregnant and give birth to a son, and you are to name him Jesus. 32 This one will be great and will be called Son of the Most High, and Jehovah God will give him the throne of David his father, 33 and he will rule as King over the house of Jacob forever, and there will be no end to his Kingdom.

    Here is a major difference between what you and I believe. You believe as far I understand your belief, that an Archangel gave up his life in heaven to be transerred to the womb of Mary to become a man. And so his life force (spirit of life) was transferred. I on the other hand believe God engendered Jesus to Mary by a miraclous conception = begotten = the beginning = origin of Jesus in reality! Matt 1:1-20
    Jesus had a Mother and a Father. The scripture says Jesus origin was out of Mary (Matt 1:16) and Out of God's holy spirit (Matt 1:18,.20)

    If it was a transfer or in-vivo fertilization of a previous person, than it would be THROUGH (Greek = dia) Mary and NOT (out of) her as being a source of origin.

    Ek is the Greek preposition meaning (out of) It is the genitive of origin or source of origin. So we have the two sources for a conception or a begetting to occur, out of the Fathers holy spirit and out of the Mothers seed cell.

    I don't see this as difficult thing for God! Since he is the source or fountain of life. Ps 36:9.

    I have no problem with Jesus as he was growing up, would have known he was in his fathers house. The earth is figuratively God's foot stool. He was about 12 years at this time and quite knowledgeable, I'm sure his mother too would have taught him about his miraclous birth, and destiny. And he continued to grow in knowledge and wisdom, and physcial strength and in favor with God and men. Luke 2:40, 52.
    I don't see these scriptures, meaning any pre-existence. Each of these are in harmony with anyone who is commissioned as a prophet of God.

    For example: John the Baptist, did he speak personally with God?

    ** Jn 1:33 Even I did not know him, but the very One who sent me to baptize in water said to me: ‘Whoever it is upon whom you see the spirit coming down and remaining, this is the one who baptizes in holy spirit

    Did he exist alongside Jesus in heaven as God's personal messenager before being sent to earth to prepare the way for God?????

    ** Mal 3:1“Look! I (Jehovah) am sending my messenger(John the Baptist), and he will clear up a way before me.

    ** Matt 11:10 This is the one about whom it is written: ‘Look! I am sending my messenger ahead of you, who will prepare your way ahead of you!

    Yes, Jesus and John the baptist were in God's mind and heart as to his future purpose. They existed only in the eyes of God at that time!. That was at least 400 -700 years before they both became reality by means of miraclous births. Jesus had existed in the eyes of God long before that as the lamb slaughtered before the founding of the world (Gen 3:15, 21).That did not become a reality until the first century.

    On John 8:38 I speak the things which I have seen with My Father;

    This scripture is taken as literally, to prove a pre-existence, but it does not conclusively do that! As Jesus following words clearly show he was speaking spiritually. The opposers were from their father the devil and they were doing the things they had learnt from their father while Jesus was doing that which he had learnt from his spiritual Father.
    In v 40 he identifies himself as a man. And according to the Bible was 30 + years of age.

    There are many occassion, when Jesus would have been with his father without having to have a pre-existence, as in prayer, when he meditated, when he was alone and studing the scriptures, when the angels came and ministered to him. When he received his commissioned as a prophet just as all prophets do. We all can see the father just by the things we see around us. Rom 1:20. And not only that Jesus was a sinless man, perfect and blamless, as was Adam before he sinned, and no doubt enjoy a special relationship that Adam had enjoyed before he sinned.

    If we were to take every thing Jesus speaks and says as literal, than we may as well believe the trinity. For how would you justify this scripture???

    ** Jn 14:7 If you men had known me, you would have known my Father also; from this moment on "you know him" and "have seen him"


    Again, these scriptures while seemingly giving the appearence that jesus has a pre-existence, can be understood from the point of view he was "a man" just as John the baptist says he was in verse 30. And If he is a man (and of 30 + years) than how can the discrepancies be understood? Pre-existent believer solve it by assuming he was an angel from a former time. However, there are two logical ways to understand this without assuming a pre-existence.

    1) From the point of view that John is "explaining from the scriptures", events his inquirer would have been familiar with! Since there were no Chapters or verse number to give reference to, he was showing by reference how the scriptures applied to him and Jesus who followed him.

    He was in effect saying to the Jewish inquirers that he had existed in God's eyes as the messenager, the voice in the wilderness,(as written in Isaiah and Malachi, approx 400-700 bce) But that Jesus was the one who existed before him in scripture as the lamb slaughtered before the founding of the world as written in Moses (aprox 1513 bce) and he is the more important one as he takes the sins of the world away..

    And 2) the scriptures themselves, bring these points out.

    On John 1:15,30 : Again we have an issue with translation, most translators know it means superior but then give it order of time rather than order of placement or dignity or rank. And it can be translated as this
    ** Jn 1:15 REV Bible
    John testified about him, and cried out, saying, “This was he of whom I said, ‘He who comes after me has surpassed me, for he was my superior.

    The Emphatic Diaglott put out by the wts also renders it similarly.

    ēn (ἦν) = verb the imperfect tense, active voice of eimi, (εἰμί) the common word for “to be” he was and continues to be

    The Greek word protos, which means “first.” It can refer to being “first” in time, and thus be translated “before,” or it can mean first in rank, and be translated “chief,” “leader,” “greatest,” “best,

    Protos is the superlative of pro.

    The word emprosthen, which means “to be before, ahead of, or higher in position or rank than someone.” “To become” of a higher rank than someone is to “advance in front of someone” or to surpass him, thus, “has surpassed me

    Superlative of πρό (G4253) πρό pró, pro; a primary preposition; "fore", i.e. in front of, prior (figuratively, superior) to:—above, ago, before, or ever.

    Understanding John's words, is pretty simple, John is pointing out that his ministry is being suppassed by Jesus ministry and it is to go on increasing because he is the most important one and he was John's leader or savour.
    Probably the most controversal portion of scripture in the Bible. And it is all comes down to interpretation. Since I believe Jesus is a man who came into existence to his mother and father in the first century. Than, I am not pursuaded by a preconceived idea he is an archangel.

    So when the scriptures says it was Jesus Christ (Named Jesus 8 days after his birth) (And offically the Christ at his baptism 30 years later) It is "this man" who is existing in God form. That is he is a sinless man, anointed with the spirit to have the authority of God. = in God's form, meaning he represents God.

    He demonstrated that by, forgiving sin, healing cripples, raising the dead, speaking to the elements storms and fish and bread and they obeyed but rather than expect others to serve him as lord or king he humbled himself and served others setting the example for us to follow. So he was certianly in the form of God. Taking the form of a slave he washed the feet of his disciples and taught them to do the same -- if anyone wants to be great than they should serve others. Luke 22:24-27. Jn 14:13-15.

    Being made in the likenss of men is not an excact copy, he came to be like sinners (ordinary men, like his brothers) and became to be viewed as a sinner and accused as a sinner and even died as a sinner even though he did not sin, so as to become a merciful high priest. Heb 2:16-18
     
    Londoner likes this.
  14. 4,693
    840
    113
    Joshuastone7

    Joshuastone7 Administrator Staff Member

    Joined:
    Jan 26, 2013
    Messages:
    4,693
    Likes Received:
    840
    Trophy Points:
    113
    Gender:
    Male
    Phil 2:5-9 "Keep this mental attitude in you that was also in Christ Jesus, who, although he was existing in God’s form, gave no consideration to a seizure, namely, that he should be equal to God. No, but he emptied himself and took a slave’s form and became human. More than that, when he came as a man, he humbled himself and became obedient to the point of death, yes, death on a torture stake. For this very reason, God exalted him to a superior position and kindly gave him the name that is above every other name."

    Regardless of the ridiculous argument of this thread, Jesus came from heaven physically.

    If some would like to continue in falsehood, then let that be your choice. We have clarified Gods word to you.
     
  15. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    Show me where it is PAST TENSE?????

    "Was existing in God form" is in present active tense, meaning it was the status of Jesus during his ministry that was observable by the disciples as It happen in real time.

    If it was past tense it would have said: Who HAD BEEN existing in God form.

    No one disagrees that Jesus "life" came from heaven. His father was God. You say his life comes from "out of" an archangel.

    I say his life comes "out of" the father's holy spirit as stated in Matt 1:18, 20. A miraculous begetting or conception.

    You want to call that ridiculous and false! You go ahead, but that is God's word, and I just believe it!
     
    Londoner likes this.
  16. 4,693
    840
    113
    Joshuastone7

    Joshuastone7 Administrator Staff Member

    Joined:
    Jan 26, 2013
    Messages:
    4,693
    Likes Received:
    840
    Trophy Points:
    113
    Gender:
    Male
    You disregard normal communication. It is past tense because it says after that he became human...

    Phil 2:5-9 "Keep this mental attitude in you that was also in Christ Jesus, who, although he was existing in God’s form, gave no consideration to a seizure, namely, that he should be equal to God. No, but he emptied himself and took a slave’s form and became human."

    It's very simple, it's not complicated, it's in black and white.
     
  17. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    Ok, so to you it is black and white! But, to my eyes, it's, not all that clear. You will just have to pardon my ignorance, I really don't see what your seeing.

    You say I'm disregarding normal communiation! Maybe I am I don't know!

    I'm sorry butit seems to be saying from the context that we are to observe the man Jesus Christ and imitate his qualities of humility, who seem to have the high office of God bestowed upon him but rather than be served chose rather to serve his fellowman by becoming like them in every respect even though he was perfect and having the authority,(form) of God.

    So that I can understand you and the text better, can you, please explain for me according to your view, the following?

    1. Who is Jesus Christ in this text?

    2. When did he come into existence?

    3. When was he named Jesus?

    4. When did he become The Christ?

    5. Is Jesus Christ a sinless man?

    6. When would Jesus have been a mature man?

    7. Is there in your opinion a difference between a sinful man and a sinless man? Or are they the same?

    8. Is the context of Phil 2 about Jesus Christ the man, or Is it about Jesus Christ an archangel?

    9. Was he (out of) God's holy spirit as explained by Matthew 1:18,and vs 20?

    10. Was he (out of) Mary his mother as explained by Matthew at Matt 1:16, (note also vs 3,5,6) Perhaps, check out your Kingdom Interlinear (I may be reading mine wrong.)

    11. Does Matthew say he was (out of) an archangel?

    12. What does form mean to you in these texts?

    13. What exactly is the form of a slave???

    14. Are you saying, he was 1st in the form of God, than 2nd he became in the form of a slave, and than 3rd he became human, than 4th then he was fashioned as man?

    15. Could someone who is in the form of a lawyer also be in the form of a slave?

    16. Could someone change their form, say from the form of a villian to the form of a benefactor by having a change of mind and heart?

    17. To you does the word “form” carry the notion of “character” for example having the characteristics of a slave or the characteristics of a lawyer?

    18. Does in the form of God also mean in the Image of God?

    19. When it say he became human does that mean he became a “sinful” human?

    20. Was Jesus made of sinful flesh or sinless flesh?

    21. Did he become like his brothers or fellowman experiencing the effects of sin and death by sinning?

    22. Would you say Jesus was perfect, in the form/image of God as was the first Adam (before he sinned)?? Gen 2:7-8, Gen 1:26.

    23. When do you think, he would have been made like his brothers or fellowman, (like sinful humans)? Heb 2:16-18, Rom 8:3

    24. Would that have been, at his birth or at his death?
    I look forward to your honest apprasial of these questions as I seek the truth about whether Jesus pre-exist himself, and that is, he lived before, his Mother or his Father gave birth to him?
     
    Londoner likes this.
  18. 162
    13
    18
    Imabetterboy

    Imabetterboy Member

    Joined:
    Mar 26, 2018
    Messages:
    162
    Likes Received:
    13
    Trophy Points:
    18
    Gender:
    Male
    Greetings Joshua!

    While waiting for your reply to my last post, I thought of a modern rendering of the verse that may help you see how I view Phil 2:5-9. and the present tense of the sentence structure.

    Adaping the theme from Undercover Boss, a TV reality show, I thought it might help in understanding this difficult verse.

    Keep this mental attitude in you that was also in Warren Buffett who, although he was existing in the form of CEO,.....took the form of a worker, and became an employee, and after finding himself as a employee humbled himself and endured the terrible working conditions his employees were experiencing even scrubbing floors with a hand brush.

    Not out to change your religious view but to show there are other ways of understanding texts that maybe, or maybe not, equally true.

    Christian love!
     
    Londoner likes this.

Share This Page